The average on this exam was a 56. Yes, it was a bit low, but it is not out of the ordinary for the exam on this material.
Just a reminder, each exam is not curved. Only the final point total at the end of the semester will be considered for curving.
Matching - use the choices below to answer questions 1 to 6. Be sure to choose the best answer.
I. Glycolysis
II. Conversion of Pyruvate to Acetyl CoA
III. Krebs Cycle
IV. Electron Transport Phophorylation (Chemiosmosis)
V. Lactic Acid Fermentation
VI. Alcohol Fermentation
VII. Light-Dependent Reactions of Photosynthesis
VIII. Light-Independent Reactions of Photosynthesis (Calvin Cycle)
1. This/these processes produce ATP
A. I, III B. I, III, IV C. I, III, IV, V, VI
D. I, III, IV, VII E. None of the above
2. This/these processes have a net consumption of ATP
A. I B. V, VI C. I, V, VI
D. VIII E. None of the above
3. This/these processes produce NADH
A. I, III B. I, II, III C. I, II, III, IV
D. I, III, IV, VII E. None of the above
4. This/these processes produce convert NADH to NAD+
A. I, II B. I, II, III, IV
C. I, IV, V, VI D. VII E. None of the above
5. This/these processes produce CO2:
A. III B. II, III C. II, III, VI
D. II, III, V, VI E. None of the above
6. This/these processes produce NADPH
A. I, III B. I, II, III C. I, II, III, IV
D. VII E. None of the above
7. In non-cyclic photorespiration, from where does PSII replenish its lost electron?
A. CO2 B. O2 C. H2O
D. PSI E. NADPH
8. On a hot, sunny day, where would you expect the pH to be lowest?
A. Cytoplasm B. Thylakoid space
C. Stroma D. The space between the outer and inner chloroplast membrane
9. Where would you expect to find the highest concentration of PSII
A. On the outer chloroplast membrane
B. On the inner chloroplast membrane
C. On the thylakoid membrane
D. On the outer mitochondrial membrane
E. On the inner mitochondrial membrane
10. Plant cells have functional mitochondria
A. True B. False
Thankfully, almost everybody got this one correct
11. Assume a thylakoid is somehow punctured so that the interior of the thylakiod is no longer separated from the stroma by an intact membrane. This damage will have the most direct effect on which process?
A. flow of electrons from photosystem II to photosystem I
B. the absorption of light energy by chlorophyll
C. the reduction of NADP+ to NADPH
D. the synthesis of ATP by ATPsynthase
E. None of the above
12. The reactions of the Calvin cycle require all of the following molecules, EXCEPT
A. CO2 B. RuBP C. glucose
D. NADPH E. ATP
13. Which of the following produces ATP and NADPH?
A. Glycolysis B. Krebs Cycle
C. Calvin Cycle D. Cyclic photophosphorylation
E. Non-cyclic photophosphorylation
14. Which of the following statements about leaves is FALSE?
A. Simple leaves have only one blade
B. Most of the light harvesting takes place in the palisade mesophyll
C. The leaf cuticle secretes a waxy cuticle
D. C4 plants usually possess Kranz Anatomy
E. All of the above statements about leaves are TRUE
15. In a C4 plant, what enzyme fixes CO2 in the bundle sheath?
A. PEP Carboxylase B. Rubisco
C. Malate dehydrogenase D. ATPase E. None of the above
16. Which of the following photosynthetic systems is most efficient in moist environments?
A. C3 B. C4 C. CAM
17. Which state would you expect to find the highest concentration of C4 plants?
A. California B. Kansas
C. Illinois D. New York
18. An increase in atmospheric CO2 should lead to increased agricultural yields
A. True B. False
19. Fats can use some of the cellular respiration reactions, by using beta oxidation to cut their fatty acids into two-carbon molecules, which are fed into respiration as:
A. FADH2 B. AcetylCoA
C. Pyruvate D. Double CO2
20. Where is ATP synthase located in the mitochondrion?
A.matrix B. inner membrane
C. ribosome D. cytochrome system
21. Which stage of respiration produces the most ATP?
A. Glycolysis B. Krebs Cycle
C. Oxidative Phosphorylation D. Fermentation
E. None of the above
22. Which of the following statements about respiration pathways is FALSE?
A. Glycolysis can be divided into two halves, an initial energy-requiring portion and the second, energy-releasing portion
B. Glycolysis is performed in the matrix
C. H2O is formed in oxidative phosphorylation
D. Lactic acid fermentation is performed by your muscles when they are starved of O2
E. All of the above statements about respiration pathways are TRUE
23. Which characteristic is true of both alcohol and lactic acid fermentation?
A. In the absence of oxygen, sulfur can be used to make H2S instead of H2O
B. Pyruvate is broken down to form 2 more molecules of ATP
C. CO2 is given off
D. electrons that were given to NAD+ to make NADH are released, so that NAD+ can be recycled back to glycolysis
E. None of the above
24. Which of the following statements about the Calvin-Benson Cycle is FALSE?
A. The reactions of the Calvin-Benson Cycle occur in the stroma
B. Rubisco is the enzyme responsible for fixing CO2 in the Calvin-Benson Cycle
C. A glucose molecule is produced for every three "turns" of the cycle (i.e. three CO2's are brought in and fixed)
D. Reaction is fueled by the ATP and the NADPH produced in the light-dependent reactions
E. All of the above statements are TRUE
25. How many molecules of CO2 are generated for each molecule of Acetyl CoA introduced into the Krebs cycle?
A. 1 B. 2 C. 3
D. 4 E. 5
26. The scientist(s) who first published the Nature article on the structure of DNA was/were:
A. Frederick Griffith B. Avery, McCarthy, & MacLeod
C. Watson & Crick D. Hershey & Chase
E. None of the above
27. The scientist(s) who performed the X-ray crystallography work that was used by the above without permission was/were:
A. Frederick Griffith B. Avery, McCarthy, & MacLeod
C. Watson & Crick D. Hershey & Chase
E. None of the above
It was Roslind Franklin
28. The enzyme responsible for removing supercoils from unwinding DNA is:
A. Topoisomerase B. Ligase C. DNA Polymerase III
D. Telomerase E. Helicase
29. The goal of the Hershey-Chase experiment was to:
A. Illustrate bacterial transformation
B. Determine whether protein or DNA was the molecule of heredity
C. Determine the structure of DNA
D. Determine whether DNA replication was conservative, semi-conservative, or dispersive
E. None of the above
30. In a DNA nucleotide, there is a phosphate group attached to the ______ carbon and a hydroxyl group (-OH) attached to the ______ carbon
A. 5' 3' B. 3' 5' C. 1' 5'
D. 5' 1' E. 1' 3'
31. This enzyme is unable to function properly unless a primer is present.
A. Topoisomerase B. Ligase C. DNA Polymerase III
D. Telomerase E. Helicase
32. On which end of a DNA molecule would you expect telomerase activity to be greatest?
A. The 5' end B. The 3' end
C. Both ends equally
This one was a thinker - the primer on the 5' end of each strand will fall
off, making the strand shorter on the 5' end.
33. Which of the following questions about DNA and events associated with DNA is FALSE?
A. DNA replication is semiconservative
B. Topoisomerase is most active during the S phase of the cell cycle
C. A newly replicated DNA molecule is actually composed of DNA and the many RNA primers that were left behind
D. A leading strand is longer than a lagging strand
E. All of the above statements are TRUE
My exam and quiz watchdog (and you know who you are!) informed me that both C and D were correct, and I agreed. I meant to say that a leading strand is longer than an Okazaki fragment. Credit was given to both answers
Given the template strand below, answer questions 34 to 36
3' G T G C T A C G G C T A A T G T C C C A T T G G 5'
34. Which of the strands below is the coding strand?
A. 3' GTGCTACGGCTAATGTCCCATTGG 5'
B. 3' GGTTACCCTGTAATCGGCATCGTG 5'
C. 3' CCAATGGGACATTAGCCGTAGCAC 5'
D. 3' CACGATGCCGATTACAGGGTAACC 5'
E. None of the above
35. What is the third amino acid code for in the mRNA that is transcribed from this template strand?
A. Alanine B. Glycine C. Isoleucine
D. Histidine E. Proline
36. If the T with the two ** above it was changed to an A, what would be the resulting change in the protein
A. Leucine changes to Glutamine B. Aspartic Acid to Valine
C. Isoleucine changes to Phenylalanine D. “Stop” changes to Phenylalanine
E. No change in the protein
37. Which of the following mutations usually has the least effect on the protein?
A. Neutral B. Missense
C. Nonsense D. Frameshift
38. What is the anticodon of 5' CAU 3?
A. 5' GUA 3' B. 3' GUA 5'
C. 5' CAU 3' D. 3' CAU 5'
39. What amino acid is attached to a tRNA with the following anticodon: 3' CAU 5'
A. Histidine B. Tyrosine C. Methionine
D. Valine E. None of the above
40. Which of the following is not necessary for initiation of translation?
A. A charged tRNA in the A site B. A charged tRNA in the P site
C. A small ribosomal subunit D. A large ribosomal subunit
E. All of the above are necessary for initiation of translation
41. Which of the following statements about translation in eukaryotes is FALSE?
A. rRNA acts as a catalyst and catalyzes the peptide bond formation and breaks the bond between polypeptide chain and tRNA in P site
B. During translocation, the tRNA in the A site moves to the P site
C. During translocation, the uncharged tRNA will be ejected from the E site
D. The release factor causes the addition of a water molecule instead of an amino acid to the polypeptide chain.
E. All of the above statements about translation in eukaryotes are TRUE
42. You have several thousand operons in your genome
A. True B. False
43. Which of the following statements about the lac operon is FALSE?
A. The repressor protein has an allosteric site
B. If the concentration of lactose is low, one can expect the concentration of cAMP to also be low
C. cAMP is necessary to allow RNA polymerase to easily bind to the promoter
D. When the lac operon is turned on, all three genes (lac Z, lac Y, and lac A) will be transcribed
E. All of the above statements about the lac operon are TRUE.
The concentration of cAMP is dependent upon the concentration of
glucose, not lactose
44. Most of the genetic regulation in eukaryotes is seen at which level?
A. Transcription Control B. Post-Transcription Control
C. Translation Control D. Post-Translation Control
E. None of the above
45. The basal promoter in most eukaryote genes contains the following:
A. TFIID B. TATA box C. CAAT box
D. RNA pol II E. None of the above
TFIID binds to the TATA box, but the TATA box is what is part of the basal promoter
46. Which of the following statements about a protein with a leucine zipper is TRUE?
A. The protein is unstable in water B. The protein is a DNA binding protein
C. The protein is an enzyme D. The protein is an enhanser
E. None of the above
47. Prokaryote DNA synthesis has many replication bubbles
A. True B. False - they only contain one
replication origin, therefore there is only one replication bubble
48. Which of the following statements about Post-Transcriptional control of DNA in eukaryotes is FALSE?
A. A 5' guanine cap is added to promote mRNA stability
B. A 3' polyA tail is added to promone mRNA stability
C. Spliceosomes remove exons from the pre-mRNA
D. Post-translational modifications of mRNA occur in the nucleus
E. All of the above statements about mRNA are TRUE
49. If a person had a mutation so that all of their TFIID proteins were unable to bind to DNA, what would happen?
A. Nothing would happen - TFIID is only found in prokaryotes
B. The lack of TFIID binding would only marginally show down transcription
C. Only genes involved in growth would be affected
D. The transcription of almost all genes would be affected - the person would die.
50. Sometimes signal sequences are added to proteins which mark them for transport by the Golgi bodies
A. True B. False
EXTRACREDITEXTRACREDITEXTRACREDITEXTRACREDITEXTRACREDITEXTRACREDIT
51. Which of the following prevents the activation of one gene from accidentally activating a nearby gene?
A. Insulator B. TFIID C. Enhancer
D. Spacer
52. Which of the following statements about global CO2 is FALSE?
A. Global CO2 has been steadily increasing since the time of the industrial revolution
B. Increased CO2 will help C3 plants more than C4 plants
C. Increased CO2 will actually improve agricultural yields
D. Fossil fuel emissions are thought to be the primary cause of atmospheric CO2 increases.
E. All of the above statements about global CO2 levels are TRUE
53. Which of the following statements about Electron Transport Phosphorylation is FALSE?
A. Each NADH oxidized to NAD+ ultimately pumps three H+ into the intermembrane space
B. Each FADH2 oxidized to FAD+ also ultimately pumps three H+ into the intermembrane space
C. Each H+ pumped into the intermembrane can be used to produce one ATP by ATPase
D. Electron Transport Phosphorylation can produce up to 32 ATP per glucose molecule
E. All of the above statements about Electron Transport Phosphorylation are TRUE
FADH2 is only worth 2 ATP, not 3. A bit picky, but it is extra
credit
54. Which of the following are valid results of the Messelson-Stahl experiment to determine the nature of DNA replication?
A. After one round of replication, there were two bands, one corresponding to 100% heavy and one corresponding to 100% light
B. After one round of replication, there was one band, corresponding to 100% light
C. After two rounds of replication, there was one band, corresponding to 75% light, 25% heavy
D. After two rounds of replication, there were two bands, one corresponding to 50% heavy, 50% light and one corresponding to 100% light
E. None of the above