1. Plant cells that are living at maturity with thick primary cell walls that function in support of the plant are:
A. Parenchyma B. Collenchyma C. Schlerenchyma D. Xylem2. This plant tissue type makes up the bulk of the plant, is predominately parenchyma, and has diverse functions including photosynthesis, storage, and support
A. dermal tissue B. ground tissue C. vascular tissue3. Shoot growth which results in an increase in length is derived from a(n)
A. apical meristem B. vascular cambium C. cork cambium4. Which of the following is responsible for branching in dicots?
A. apical meristem B. lateral (axillary) meristem C. vascular cambium5. Apoplastic transport of water is possible in all of the following tissues EXCEPT:
A. epidermis B. cortex C. endodermis D. pericycle6. Which of the following plants has scattered vascular bundles?
A. monocots B. herbaceous dicots C. woody dicots7. Where does meiosis occur in a fern?
A. The gametophyte B. The sporophyte8. Which of the following plants has a free-living gametophyte?
A. Boston fern (fern) B. pine tree (conifer) C. daisy (angiosperm)9. Where is the pollen made in an angiosperm?
A. sepal B. petal C. anther D. ovule10. Which of the following tissues is HAPLOID?
A. sepal B. petal C. anther D. ovule E. none of the above11. A seed is a ripened __________
A. petal B. anther C. ovary D. ovule12. Water movement between the cell walls and intercellular spaces is
A. symplastic movement B. apoplastic movement13. The interaction between plant roots and mycorrhizae is detrimental to the plant
A. True B. False14. Which of the following statements of the Transpiration-Cohesion-Tension model oftranspiration is FALSE?
A. Evaporation of water from the leaves generates the initial pull of water up the xylem15. Which of the following statements about stomates is FALSE?
B. Water has low cohesive properties and this reduces friction as it flows up the xylem
C. Water adheres to the xylem walls preventing backflow
D. All of the above statements of the Transpiration-Cohesion-Tension model of transpiration are TRUE
A. Stomatal opening and closing is the function of the guard cells16. Which of the following statements about sucrose loading and transport is FALSE?
B. When the stomates are open, the internal concentration of K+ is low
C. Stomatal opening is triggered by light
D. Stomatal opening is also tied to a 24 hour cycle (a circadian rhythm)
E. All of the above statements about stomates are TRUE
A. Sucrose is produced in the mesophyll cells and travels via the symplast to the sieve-tube memberMatching - Match the stage of mitosis and the cell cycle on the left with the appropriate description on the right
B. Sucrose is loaded into the phloem via an ATP- powered H+/sucrose symport
C. The water potential in the sieve-tube element is lower than in the surrounding cells
D. All of the above statements about sucrose loading and transport are TRUE
A. DNA polymerase is more active occurs during this stage17. Prophase - (D)
B. The centromeres break during this stage
C. The majority of Cytokinesis occurs during this stage
D. The nuclear membrane dissolves during this stage
E. The chromosomes all line up in the equator during this stage
20. During what stage of the cell cycle is cyclin concentration the greatest?
A. G1 B. S C. G2 D. M E. G021. During which stage of cell division does crossing over occur?
This is what was accepted on the key, but I will accept "C" as well.
A. Prophase of mitosis B. Prophase I C. Prophase II22. What type of cell would not exhibit contact inhibition?
A. Lung cells B. Muscle cells C. Nervous cells D. Cancerous cellsMatching - Match the enzyme on the left with the appropriate function on the right
A. Can proofread the DNA23. RNA polymerase - Thrown out - everyone got credit (It shoud have said "primase)
B. Generates the primer for DNA synthesis
C. Unwinds the DNA
D. Untangles the DNA - prevents supercoiling
E. Seals nicks in DNA (joins adjacent 3' -OH and 5' phosphate groups)
Matching - Match the scientist on the left with their contribution to science on the right
A. First described the structure of DNA26. Frederick Griffith - (B)
B. First described the phenomenon of bacterial transformation
C. Demonstrated that DNA replication is semi-conservative
D. Worked with proteases and DNAses to determine the agents of transformation
E. Worked with radiolabeled bacteriophages and demonstrated that DNA was the molecule of heredity
29. Which of the following statements about telomeres is TRUE?
30. Which of the following was NOT used as evidence that DNA is the molecule of heridity?A. Bacteria do not contain telomere
B. Telomeres are found in the center of eukaryotic chromosomes
C. Telomeres do not contain functional genes
D. Telomeres are degraded by telomerase
E. All of the above statements about telomeres are FALSE
A. Chargaff's rule (%A = %T and %G = %T)31. What is the function of aminoacyl t-RNA synthetases?
B. Diploid cells have twice as much DNA as their haploid gametes
C. There are only four bases in DNA which is less confusing
D. Prior to mitosis, eukaryotic cells exactly double their DNA
A. To ensure that the correct amino acid is charged to the appropriate tRNA
B. To synthesize tRNA
C. To form the peptide bond
D. To hook up the starter tRNA, mRNA, and small ribosomal subunit
E. None of the above
32. What is the anticodon of 5' ACG 3'
A. 5' UGC 3' B. 3' UGC 5' C. 5' TGC 3' D. 3' TCG 5'33. A frameshift mutation will generally affect more amino acids in a protein than a point mutation
A. True B. FalseGiven the below template strand of DNA, answer the following three questions (34 to 36):
5' G G T T A A C C G C G C A A G G G C A T G C G G 3'34. What is the coding strand of DNA?
A. 5' GGTTAACCGCGCAAGGGCATGCGG 3'
B. 3' GGTTAACCGCGCAAGGGCATGCGG 5'
C. 5' CCAATTGGCGCGTTCCCGTACGCC 3'
D. 3' CCAATTGGCGCGTTCCCGTACGCC 5'
E. 5' CCAAUUGGCGCGUUCCCGUACGCC 3'
35. How many amino acids are in the protein coded by this piece
of DNA
A. four B. five C. six D. seven E. eight36. If the base with the star (*G) was changed to a C, what would be the change to the protein?
A. no change to the protein
B. Glycine to alanine
C. Alanine to glycine
D. Proline toargeninealanine
E.ArgenineAlanine to proline
37. If the lacI gene is deleted, what will be the effect on the
lac operon?
A. The operon will be temporarily turned off38. If lactose and glucose are present, will the lac operon be on or off?
B. The operon will be permanently turned off
C. The operon will be permanently turned on
A. On B. Off39 If there is a high concentration of lactose and a low concentration of glucose, which of the following statements will be TRUE?
A. Lactose will bind to the operator and turn off the lac operon40. Which of the following is NOT a modification made to a pre-mRNA?
B. Lactose will cause a conformation change in the repressor protein and it will bind to the operator
C. lacZ, the gene which produces beta-galactosidase will be turned on, but lacY, the gene that produces permease, will be turned off
D. Cyclic AMP (cAMP) concentration will be low and CRP will bind to the CRP binding site, allowing RNA polymerase to bind to the promoter
E. All of the above statements about the lac operon are FALSE
A. A 5' Guanine cap is added to the pre-mRNA41. If an enhancer is moved to another location in the genome, or if an unrelated gene is placed near an enhancer, transcription of the adjacent gene is enhanced
B. A poly A tail is added to the pre-mRNA
C. Introns are removed by a spliceosome
D. All of the above are modifications made to a pre-mRNA
A. True B. False42. Which of the following is NOT a role of the circulatory system
A. Thermoregulation B. Waste Removal C. Immunity D. Cellular Communication E. All of the above are roles of the circulatory system43. Arteries ALWAYS carry blood away from the heart
A. True B. False44. Which blood vessel carries blood from the right ventricle to the lungs?
A. Vena cava B. Pulmonary Artery C. Pulmonary vein D. Aorta45. Oxygen binds to _______ in red blood cells
A. A reaction center B. hemoglobin C. myoglobin D. oxysome E. none of the above46. Which of the following statements about ventilation of the lungs is FALSE?
A. Inhalation is caused by a contraction of the diaphragm47. Gas exchange in the lungs occurs in the
B. Air is actively forced into the lungs when one inhales.
C. Exhalation is caused by a relaxation of the diaphragm
D. All of the above statements about ventilation are TRUE
A. pharynx B. larynx C. epiglottis D. bronchi E. alveoli48. What is the function of HCl in the stomach?
49. Which of the organs below has the greatest internal surface area?
A. Mouth B. Stomach C. Small Intestine D. Large Intestine50. What is the function of bile?
51. Extra Credit: What is your instructor's field of research?
A. Human evolution B. Plant evolution C. Dinosaur evolution
D. Microbial evolution E. Acting