BIOS 100 - Summer 2001
Exam II

1. Plant cells that are living at maturity with thick primary cell walls that function in support of the plant are:

A. Parenchyma B. Collenchyma C. Schlerenchyma D. Xylem
2. This plant tissue type makes up the bulk of the plant, is predominately parenchyma, and has diverse functions including photosynthesis, storage, and support
A. dermal tissue B. ground tissue C. vascular tissue
3. Shoot growth which results in an increase in length is derived from a(n)
A. apical meristem B. vascular cambium C. cork cambium
4. Which of the following is responsible for branching in dicots?
A. apical meristem B. lateral (axillary) meristem C. vascular cambium
5. Apoplastic transport of water is possible in all of the following tissues EXCEPT:
A. epidermis B. cortex C. endodermis D. pericycle
6. Which of the following plants has scattered vascular bundles?
A. monocots B. herbaceous dicots C. woody dicots
7. Where does meiosis occur in a fern?
A. The gametophyte B. The sporophyte
8. Which of the following plants has a free-living gametophyte?
A. Boston fern (fern) B. pine tree (conifer) C. daisy (angiosperm)
9. Where is the pollen made in an angiosperm?
A. sepal B. petal C. anther D. ovule
10. Which of the following tissues is HAPLOID?
A. sepal B. petal C. anther D. ovule E. none of the above
11. A seed is a ripened __________
A. petal B. anther C. ovary D. ovule
12. Water movement between the cell walls and intercellular spaces is
A. symplastic movement B. apoplastic movement
13. The interaction between plant roots and mycorrhizae is detrimental to the plant
A. True B. False
14. Which of the following statements of the Transpiration-Cohesion-Tension model oftranspiration is FALSE?
A. Evaporation of water from the leaves generates the initial pull of water up the xylem
B. Water has low cohesive properties and this reduces friction as it flows up the xylem
C. Water adheres to the xylem walls preventing backflow
D. All of the above statements of the Transpiration-Cohesion-Tension model of transpiration are TRUE
15. Which of the following statements about stomates is FALSE?
A. Stomatal opening and closing is the function of the guard cells
B. When the stomates are open, the internal concentration of K+ is low
C. Stomatal opening is triggered by light
D. Stomatal opening is also tied to a 24 hour cycle (a circadian rhythm)
E. All of the above statements about stomates are TRUE
16. Which of the following statements about sucrose loading and transport is FALSE?
A. Sucrose is produced in the mesophyll cells and travels via the symplast to the sieve-tube member
B. Sucrose is loaded into the phloem via an ATP- powered H+/sucrose symport
C. The water potential in the sieve-tube element is lower than in the surrounding cells
D. All of the above statements about sucrose loading and transport are TRUE
Matching - Match the stage of mitosis and the cell cycle on the left with the appropriate description on the right
A. DNA polymerase is more active occurs during this stage
B. The centromeres break during this stage
C. The majority of Cytokinesis occurs during this stage
D. The nuclear membrane dissolves during this stage
E. The chromosomes all line up in the equator during this stage
17. Prophase - (D)
18. Anaphase - (B)
19. Interphase - (A)

20. During what stage of the cell cycle is cyclin concentration the greatest?

A. G1 B. S C. G2 D. M E. G0
This is what was accepted on the key, but I will accept "C" as well.
21. During which stage of cell division does crossing over occur?
A. Prophase of mitosis B. Prophase I C. Prophase II
22. What type of cell would not exhibit contact inhibition?
A. Lung cells B. Muscle cells C. Nervous cells D. Cancerous cells
Matching - Match the enzyme on the left with the appropriate function on the right
A. Can proofread the DNA
B. Generates the primer for DNA synthesis
C. Unwinds the DNA
D. Untangles the DNA - prevents supercoiling
E. Seals nicks in DNA (joins adjacent 3' -OH and 5' phosphate groups)
23. RNA polymerase - Thrown out - everyone got credit (It shoud have said "primase)
24. DNA polymerase  - (A)
25. Topoisomerase - (D) - yes, the notes say that topoisomerase initiates unwinding, but helicase then steps in and does the acutal unwinding

Matching - Match the scientist on the left with their contribution to science on the right

A. First described the structure of DNA
B. First described the phenomenon of bacterial transformation
C. Demonstrated that DNA replication is semi-conservative
D. Worked with proteases and DNAses to determine the agents of transformation
E. Worked with radiolabeled bacteriophages and demonstrated that DNA was the molecule of heredity
26. Frederick Griffith - (B)
27. Hershey and Chase - (E)
28. Meselson & Stahl - (C)

29. Which of the following statements about telomeres is TRUE?

A. Bacteria do not contain telomere
B. Telomeres are found in the center of eukaryotic chromosomes
C. Telomeres do not contain functional genes
D. Telomeres are degraded by telomerase
E. All of the above statements about telomeres are FALSE
30. Which of the following was NOT used as evidence that DNA is the molecule of heridity?
A. Chargaff's rule (%A = %T and %G = %T)
B. Diploid cells have twice as much DNA as their haploid gametes
C. There are only four bases in DNA which is less confusing
D. Prior to mitosis, eukaryotic cells exactly double their DNA
31. What is the function of aminoacyl t-RNA synthetases?
A. To ensure that the correct amino acid is charged to the appropriate tRNA
B. To synthesize tRNA
C. To form the peptide bond
D. To hook up the starter tRNA, mRNA, and small ribosomal subunit
E. None of the above


32. What is the anticodon of 5' ACG 3'

A. 5' UGC 3' B. 3' UGC 5' C. 5' TGC 3' D. 3' TCG 5'
33. A frameshift mutation will generally affect more amino acids in a protein than a point mutation
A. True B. False
Given the below template strand of DNA, answer the following three questions (34 to 36):
5' G G T T A A C C G C G C A A G G G C A T G C G G 3'
34. What is the coding strand of DNA?
A. 5' GGTTAACCGCGCAAGGGCATGCGG 3'
B. 3' GGTTAACCGCGCAAGGGCATGCGG 5'
C. 5' CCAATTGGCGCGTTCCCGTACGCC 3'
D. 3' CCAATTGGCGCGTTCCCGTACGCC 5'
E. 5' CCAAUUGGCGCGUUCCCGUACGCC 3'


35. How many amino acids are in the protein coded by this piece of DNA

A. four B. five C. six D. seven E. eight
36. If the base with the star (*G) was changed to a C, what would be the change to the protein?
A. no change to the protein
B. Glycine to alanine
C. Alanine to glycine
D. Proline to argenine alanine
E. Argenine Alanine to proline


37. If the lacI gene is deleted, what will be the effect on the lac operon?

A. The operon will be temporarily turned off
B. The operon will be permanently turned off
C. The operon will be permanently turned on
38. If lactose and glucose are present, will the lac operon be on or off?
A. On B. Off
39 If there is a high concentration of lactose and a low concentration of glucose, which of the following statements will be TRUE?
A. Lactose will bind to the operator and turn off the lac operon
B. Lactose will cause a conformation change in the repressor protein and it will bind to the operator
C. lacZ, the gene which produces beta-galactosidase will be turned on, but lacY, the gene that produces permease, will be turned off
D. Cyclic AMP (cAMP) concentration will be low and CRP will bind to the CRP binding site, allowing RNA polymerase to bind to the promoter
E. All of the above statements about the lac operon are FALSE
40. Which of the following is NOT a modification made to a pre-mRNA?
A. A 5' Guanine cap is added to the pre-mRNA
B. A poly A tail is added to the pre-mRNA
C. Introns are removed by a spliceosome
D. All of the above are modifications made to a pre-mRNA
41. If an enhancer is moved to another location in the genome, or if an unrelated gene is placed near an enhancer, transcription of the adjacent gene is enhanced
A. True B. False
42. Which of the following is NOT a role of the circulatory system
A. Thermoregulation  B. Waste Removal  C. Immunity  D. Cellular Communication  E. All of the above are roles of the circulatory system
43. Arteries ALWAYS carry blood away from the heart
A. True B. False
44. Which blood vessel carries blood from the right ventricle to the lungs?
A. Vena cava B. Pulmonary Artery C. Pulmonary vein D. Aorta
45. Oxygen binds to _______ in red blood cells
A. A reaction center  B. hemoglobin  C. myoglobin  D. oxysome  E. none of the above
46. Which of the following statements about ventilation of the lungs is FALSE?
A. Inhalation is caused by a contraction of the diaphragm
B. Air is actively forced into the lungs when one inhales.
C. Exhalation is caused by a relaxation of the diaphragm
D. All of the above statements about ventilation are TRUE
47. Gas exchange in the lungs occurs in the
A. pharynx B. larynx C. epiglottis D. bronchi E. alveoli
48. What is the function of HCl in the stomach?
A. it kills bacteria  B. it activates pepsin  C. it breaks down starches  D. A & B E.  A, B, & C

49. Which of the organs below has the greatest internal surface area?

A. Mouth B. Stomach C. Small Intestine D. Large Intestine
50. What is the function of bile?
A. Hydrolyzes proteins  B. Emulsifies fats  C. Breaks down starches  D. Aids in absorption of proteins  E. None of the above

51. Extra Credit: What is your instructor's field of research?
A. Human evolution B. Plant evolution C. Dinosaur evolution D. Microbial evolution E. Acting