Sample Exam Questions

These questions are taken from some of my previous exams. They are in no particular order and the numbering is meaningless.

True - False:

1. Plant cells contain mitochondria
5. All life on earth can perform glycolysis
6. Rubisco has more affinity for  CO2  than for O2 .

9. What stage of aerobic respiration produces the most ATP?

    A. Glycolysis
    B. The conversion of pyruvate to acetyl CoA
    C. The Kreb's Cycle
    D. Electron transport phosphorlyation

18. In a C4 plant, what enzyme fixes CO2 in the bundle sheath cell?

    A. PEP Carboxylase     B. Rubisco

21. Which of the following statements about ribosomes is FALSE?

    A. Ribosomes are the "factories" of the cell involved in protein synthesis
    B. Ribosomes may either be free or bound to ER
    C. Ribosomes are made up of two subunits, the large subunit and the small subunit
    D. The ribosomes of prokaryotes and eukaryotes are identical
    E. ALL of the above statements are TRUE

23. Which of the following structures aid in maintaining plant turgor pressure?

    A. chloroplast     B. ribosome      C. lysosome      D.  cell wall    E.  none of the above

31. Which of the following reaction sequences does NOT produce CO2?
    A. Glycolysis
    B. The conversion of pyruvate to acetyl CoA
    C. The Kreb's Cycle
    D. Alcoholic fermentation
    E. All of the above produce CO2

33. When does photorespiration occur?

    A. When oxygen is fixed to RuBP, not carbon dioxide
    B. When oxygen is used in the mitochondria to break down sugars
    C. When water is split to form H+, e-, and oxygen gas in the light-dependent reaction
    D. None of the above

42. Which of the following is involved in protein synthesis?

    A. rough endoplasmic reticulum
    B. smooth endoplasmic reticulum
    C. lysosome
    D. central vacuole

46. From where does p680 replenish its lost electron?

    A. CO2     B. O2  C. H2O     D. p700     E. it is never lost

47. Cyclic photophosphorylation:

    A. Involves photosystem II (p680)
    B. Allows the chloroplast to make ATP without NADPH
    C. Does not require energy from a photon
    D. Has the lost electron replaced by an electron from water
    E. None of the above

48. Which of the following statements about the Calvin-Benson Cycle is FALSE?

    A. The reactions of the Calvin-Benson Cycle occur in the stroma
    B. Rubisco is the enzyme responsible for fixing CO2 in the Calvin-Benson Cycle
    C. A glucose molecule is produced for every three "turns" of the cycle (i.e. three CO2's are brought in and fixed)
    D. Reaction is fueled by the ATP and the NADPH produced in the light-dependent reactions
    E. All of the above statements are TRUE

50. Alcoholic Fermentation:

    A. Occurs in oxygen-starved muscle cells during a strenuous workout
    B. Converts pyruvate to lactic acid and produces 2 ATP's
    C. Converts NADH to NAD+
    D. Can cause dangerous buildups of CO2 in muscle cells
    E. None of the above

30.  When does photorespiration occur?
 A.  When oxygen is fixed to RuBP, not carbon dioxide
 B.  When oxygen is used in the mitochondria to break down sugars
 C.  When water is split to form H+, e-, and oxygen gas in the light-dependent reaction
 D.  None of the above

31.  Cyclic photophosphorylation:
 A.  Involves photosystem II (p680)
 B.  Allows the chloroplast to make ATP without NADPH
 C.  Does not require energy from a photon
 D.  Has the lost electron replaced by an electron from water
 E.  None of the above

32.  Which of the following statements about the Calvin-Benson Cycle is FALSE?
 A.  The reactions of the Calvin-Benson Cycle occur in the stroma
 B.  PEP Carboxylase is the enzyme responsible for fixing CO2 in the Calvin-Benson Cycle
 C.  A glucose molecule is produced for every six "turns" of the cycle (i.e. six CO2's are brought in and fixed)
 D.  Reaction is fueled by the ATP and the NADPH produced in the light-dependent reactions
 E.  All of the above statements are TRUE

 33.  If all of the thylakoid membranes were dispupted (i.e. broken open) but all of the enzymes were still intact and functional, could the chloroplast  still manufacture ATP?
 A. Yes    B.  No

34.  From where does p680 replenish its lost electron?
 A.  CO2 B.  O2  C.  H2O D.  p700 E.  it is never lost

35.  Oxygen gas is a _________ to Rubisco.
 A.  substrate    B.  competitive inhibitor
 C.  noncompetitive inhibitor  D.  enhancer

(I accepted both answers - I was shooting for Comptetative Inhibitor, but technically, oxygen is also a substrate)

36.  Which of the following reaction sequences does NOT produce CO2?
 A.  Glycolysis   B.  The conversion of pyruvate to acetyl CoA
 C.  The Kreb's Cycle   D.  Alcoholic fermentation
 E.  All of the above produce CO2
 
37.  What stage of aerobic respiration produces the most ATP?
 A.  Glycolysis   B.  The conversion of pyruvate to acetyl CoA
 C.  The Kreb's Cycle   D.  Electron transport phosphorlyation

38.  A C4 plant does not perform the Calvin-Benson Cycle
 A.  True    B.  False

39.  Alcoholic Fermentation:
 A.  Occurs in oxygen-starved muscle cells during a strenuous workout
 B.  Converts pyruvate to lactic acid and produces 2 ATP's
 C.  Converts NADH to NAD+
 D.  Can cause dangerous buildups of CO2 in muscle cells
 E.  None of the above

40.  The majority of a plant's ATP is produced:
 A.  in the chloroplast   B.  in the cytoplasm during glycolysis
 C.  in the central vacuole  D.  in the mitochondria

 

Matching - Match the enzyme on the left with the appropriate function on the right
A. Can proofread the DNA
B. Generates the primer for DNA synthesis
C. Unwinds the DNA
D. Untangles the DNA - prevents supercoiling
E. Seals nicks in DNA (joins adjacent 3' -OH and 5' phosphate groups)
23. RNA polymerase - Thrown out - everyone got credit (It shoud have said "primase)
24. DNA polymerase  - (A)
25. Topoisomerase - (D) - yes, the notes say that topoisomerase initiates unwinding, but helicase then steps in and does the acutal unwinding

Matching - Match the scientist on the left with their contribution to science on the right

A. First described the structure of DNA
B. First described the phenomenon of bacterial transformation
C. Demonstrated that DNA replication is semi-conservative
D. Worked with proteases and DNAses to determine the agents of transformation
E. Worked with radiolabeled bacteriophages and demonstrated that DNA was the molecule of heredity
26. Frederick Griffith - (B)
27. Hershey and Chase - (E)
28. Meselson & Stahl - (C)

29. Which of the following statements about telomeres is TRUE?

A. Bacteria do not contain telomere
B. Telomeres are found in the center of eukaryotic chromosomes
C. Telomeres do not contain functional genes
D. Telomeres are degraded by telomerase
E. All of the above statements about telomeres are FALSE
30. Which of the following was NOT used as evidence that DNA is the molecule of heridity?
A. Chargaff's rule (%A = %T and %G = %T)
B. Diploid cells have twice as much DNA as their haploid gametes
C. There are only four bases in DNA which is less confusing
D. Prior to mitosis, eukaryotic cells exactly double their DNA
31. What is the function of aminoacyl t-RNA synthetases?
A. To ensure that the correct amino acid is charged to the appropriate tRNA
B. To synthesize tRNA
C. To form the peptide bond
D. To hook up the starter tRNA, mRNA, and small ribosomal subunit
E. None of the above


32. What is the anticodon of 5' ACG 3'

A. 5' UGC 3' B. 3' UGC 5' C. 5' TGC 3' D. 3' TCG 5'
33. A frameshift mutation will generally affect more amino acids in a protein than a point mutation
A. True B. False
Given the below template strand of DNA, answer the following three questions (34 to 36):
5' G G T T A A C C G C G C A A G G G C A T G C G G 3'
34. What is the coding strand of DNA?
A. 5' GGTTAACCGCGCAAGGGCATGCGG 3'
B. 3' GGTTAACCGCGCAAGGGCATGCGG 5'
C. 5' CCAATTGGCGCGTTCCCGTACGCC 3'
D. 3' CCAATTGGCGCGTTCCCGTACGCC 5'
E. 5' CCAAUUGGCGCGUUCCCGUACGCC 3'


35. How many amino acids are in the protein coded by this piece of DNA

A. four B. five C. six D. seven E. eight
36. If the base with the star (*G) was changed to a C, what would be the change to the protein?
A. no change to the protein
B. Glycine to alanine
C. Alanine to glycine
D. Proline to alanine
E. Alanine to proline 
The transpiration rate of a C3 plant is greater than that of a C4 plant
A. True *
B. False
Which of the following statements about stomates is FALSE?
A. Stomatal opening and closing is the function of the guard cells
B. When the stomates are open, the internal concentration of K+ is low *
C. Stomatal opening is triggered by light
D. Stomatal opening is also tied to a 24 hour cycle (a circadian rhythm)
E. All of the above statements about stomates are TRUE
Which of the following is NOT an adaptation seen in xeropytes?
A. Thick cuticles
B. Loss of leaves
C. White leaves
D. Sunken stomates
E. All of the above are adaptations seen in xerophytes *

37. If the lacI gene is deleted, what will be the effect on the lac operon?

A. The operon will be temporarily turned off
B. The operon will be permanently turned off
C. The operon will be permanently turned on
38. If lactose and glucose are present, will the lac operon be on or off?
A. On B. Off
39 If there is a high concentration of lactose and a low concentration of glucose, which of the following statements will be TRUE?
A. Lactose will bind to the operator and turn off the lac operon
B. Lactose will cause a conformation change in the repressor protein and it will bind to the operator
C. lacZ, the gene which produces beta-galactosidase will be turned on, but lacY, the gene that produces permease, will be turned off
D. Cyclic AMP (cAMP) concentration will be low and CRP will bind to the CRP binding site, allowing RNA polymerase to bind to the promoter
E. All of the above statements about the lac operon are FALSE
40. Which of the following is NOT a modification made to a pre-mRNA?
A. A 5' Guanine cap is added to the pre-mRNA
B. A poly A tail is added to the pre-mRNA
C. Introns are removed by a spliceosome
D. All of the above are modifications made to a pre-mRNA
41. If an enhancer is moved to another location in the genome, or if an unrelated gene is placed near an enhancer, transcription of the adjacent gene is enhanced
A. True B. False
Matching - Match the scientist on the left with their contribution to science on the right
 
Frederick Griffith 
Avery, McCarthy, MacLeod           
Hershey and Chase 
Watson and Crick 
Meselson & Stahl 		 A. First described the structure of DNA
B. First described the phenomenon of bacterial transformation
C. Demonstrated that DNA replication is semi-conservative
D. Worked with proteases and DNAses to determine the agents of transformation
E. Worked with radiolabeled bacteriophages and demonstrated that DNA was the molecule of heredity

Prokaryote DNA synthesis has many replication bubbles

A. True
B. False *
The leading strand in DNA synthesis is one continuously forming strand of DNA while the lagging strand is a series of Okazaki fragments
A. True *
B. False
Which of the following is NOT required for initiation of protein synthesis?
A. Small ribosomal subunit
B. mRNA
C. tRNA
D. aminoacyl t-RNA synthetase *
E. All of the above are required for initiation of protein synthesis
There is a tRNA with the anticodon 3' AUU 5'
A. True
B. False *  (the codon is a stop codon and there are no tRNA's which correspond to stop codons)
A frameshift mutation will generally affect more amino acids in a protein than a point mutation
A. True  *
B. False
Operons are commonly found in eukaryotic genetic systems
A. True
B. False *
Which of the following is NOT a sequence found in a promoter?
A. TATA box
B. CAAT box
C. T & A box *
D. None of the above
Which of the following is not found in a transcription factor (a protein which binds to DNA)
A. Leucine zipper
B. Zinc finger
C. Helix-turn-helix
D. Pleated shag *