Problem Set #1 SOLUTIONS BioS 101 Spring 2008

Students must attach a sheet that includes the source URL or the steps taken (calculations, if appropriate) in arriving at the answer. Credit is based on the attached sheet. Put your final answer on this sheet in the place requested.

1. (1) Find the Family, scientific species name of the following common names:

Remember to do the species capitalization properly.

Family Species

1. Rock bass Centarchidae, Ambloplites rupestris
2. Compass plant Asteracea, Silphium laciniatum

I got the names from wikipedia. There are 2 other species of Ambloplites with the common name ‘rock bass’ so those should also be accepted.

2. (1) Express the following values in g, m, or °C

a. 170 lbs 170lbs x 454g/lb = 77,180 g = 77.18x10³ g

b. 5 feet 11 inches =71 inches ÷ 39.37”m^-1 = 1.80 m

c. 88 °F (88-32)x 5÷9 = 31.1 °C

3. (1) Whole earth units.

a. How many grams is a gigaton (referred to on p. 1256)? The gigaton is a metric unit, a giga (10^9) metric tons. A ton is 1000kg and there are 1000g in a kg so a gigaton = 10¹⁵ g

2. Express the mass of the earth’s atmosphere in grams? I got this from wikipedia, 5.14 x 10²¹ g. It is calculated from atmospheric pressure.

4. (1) If a radioactive element has a half life of 48 hours, what fraction of the original amount will be left after 2 weeks? Fraction remaining =

1∙2^{-time/halflife} = 2^{-(24hrs/dayx14days/2weeks/48hrs)} =2^-7 = 1/128 = 0.0078

5. a. (1) Calculate the ‘difference matrix’ for the following sequences. The difference matrix is a row and column presentation of the pairwise difference between each of the SIX possible pairs (of 4 sequences).

Species A CAGTGCCTAAGCCAATATCCAC

Species B GGGTACCTATGCGAATATTCAT

Species C CAGTGCCTAAGCCAATATTCAT

Species D CGGTACCTATGCCAATATTCAT

The difference matrix is the organization of the counts of the number of sequence differences between pair of sequences into rows and columns as shown below. The entry in row C, column B (5)is the number of places that sequences B and C differ.

A 0

B 7 0

C 2 5 0

D 5 2 3 0

A B C D

b. (1) Which pair of sequences is the closest or most similar?

Sequences A and C have only 2 differences but B and D also only have 2 differences, so the best answer is both A&C and B&D are the closest in this set.

6. (1) Stable isotopes of an element can now be separated by an instrument called a mass spectrometer.

a. Write the chemical symbol for a radioactive isotope of carbon. ¹⁴C, on Wikipedia you will learn there are many other radioactive isotopes of C.

b. Which of the stable isotopes of carbon has the greatest mass? ¹³C

7. (1) Calculate the residence time of water in a box shaped pool 20 cm wide and 40 cm long and 2 m deep, if the input flow is 2 liters per day. Residence time equals amount divided by input (or output) rate, so 20 cm x 40 cm x 200 cm = a volume of 160x10³ cm³. 2 liters = 2*1000 cm³liter^-1 so input is 2000cm³/day. 160x10³ cm³ divided by 2000cm³/day = 80 days. Using exponential form instead of ‘per’ form = 160x10³ cm³/2000cm³day^-1

8. a. (1) Get 3 food labels. Convert the serving size to grams (it might be on the label or you may have to convert ounces to grams). How many Calories there are in a serving of each of the 3 foods? Calculate the Calories per gram for each food.

FOOD	Grams per serving	Calories per serving	Calories per gram
Peanut Butter	32	180	5.625
Elderberry Jelly	19	45	2.37
Mackerel	56	90	1.61

These will vary, but all calorie per g values should be between 7 and 0.1.

b. (1) Calculate an average Calories per gram from your 3 values. Use your average Calories per gram and the assumption of 2000 Calories per day consumption, how many pounds of food do you estimate a person eats in a 365 day year?

3.2 C/g was my average. Peanut butter is one of highest so most students will have values between 1 & 3.

2x10³ C/d x 365 d/y = 7.3x 10⁵ C/y; 7.3x 10⁵ C/y divided by 3.2 C/g

= 228,125 g; 228,125 g/454 g/lb = 502 pounds of food per year. If your foods had only 1 C/g then you would have to eat over 1500 lbs/y.