1	Polymerization and Sequence Storage of information and function are based on very large molecules (macromolecules) built from sequentially added subunits (each of which is a moderately sized molecule).
2	Reading Assignment I have assigned chapters 3 & 4 as the reading for this lecture. There is a lot of info in those chapters (most is also covered in BioS 100). I recommend concentrating your studying on the understanding the significance of the sequence order in nucleic acids and proteins.
3	The basics Reading and storing biological information is done linearly and directionally. Linear means that there are no branches or switch points. There is a beginning and an end in biological information expression.
4	Building Macromolecules Biologically important macromolecules are polymers built through linking of subunits, called polymerization. In biological polymers the order of the subunits (parts) is critical. Biological ‘information’ is read linearly and directionally (like written language).
5	Major Biological Polymers DNA and RNA are nucleic acids that store information in the sequence of bases attached to the ‘backbone’ of a chain. A Protein is a specific sequence of amino acids linked together linearly. The sequence of amino acids is known as the primary structure of the protein.
6	Nucleic Acids The nucleotide is the subunit of nucleic acids. A single nucleotide has 3 parts: one Nitrogenous base one 5 carbon sugar Phosphate (1 to 3) The subunits are linked together with a repeating sugar-phosphate(-sugar-phosphate) ‘backbone’.
7	Nucleotides All nucleotides have a nitrogenous base attached to the sugar and a phosphate attached to the sugar at a different place. The sugar in DNA is different than RNA DNA sugar is deoxyribose RNA sugar is ribose The nitrogenous bases are of two types, purines and pyrimidines.
8	Nucleotide Pairing DNA has only four different nitrogenous bases: Cytosine (C) and Thymine (T) are pyrimidines, Adenine (A) and Guanine (G) are purines. DNA is actually two very long molecules held together by many hydrogen bonds between a purine on one strand and a pyrimidine on the other. A pairs with T; G pairs with C
9	A segment of DNA ATCGCTACATGAT TAGCGATGTACTA a DNA double strand Each line represents consecutive bases in a strand (=molecule) of DNA. The two strands are held together by hydrogen bonds. The strands have a direction when one looks at the chemical details. By convention the top strand is 5’ to 3’ and the bottom strand is therefore 3’ to 5’.
10	Complementarity Because of base pairing, knowing the sequence of one strand tells one the sequence of the other DNA strand, so often the sequence of only one is given (5’ to left). When the strands match they are said to be complementary. The two strands of double stranded DNA will separate (melt) when the temperature is raised (75 to 80° C). They match up perfectly when the temp is slowly cooled.
11	Sequence Combinations Question: How many different DNA sequences are there that are 5 bases long? There are 4 ‘letters’ in the DNA ‘alphabet’. Like languages the letters are read in a direction (AT is different than TA) Solution: 4 possible choices for 1^st position, 4 possible for 2^nd, etc., so 4x4x4x4x4=1024 = 4⁵ = 2¹⁰.
12	Long Sequences won’t match by chance If one has a sequence 20 bases long, there are 4²⁰ different possible sequences, or somewhat more than 10¹², or a thousand billion. Only one out of the 10¹² possible will be an exact match to that sequence. Only 60 sequences (20 positions x 3 possible non-matches per position) will have one non-match.
13	Comparing DNA sequences Species B GGGTACCTATGCGAATATTCAT BC 12 5 * * Species C CAGTGCCTAAGCCAATATTCAT AC 2 5 * Species A CGGTACCTATGCCAATATTCAT AB 1 * Among these 3 species, A & B are closest. Their sequences differ only at positions 1 & 13.
14	Long Similar Sequences Long sequences in different organism that are similar probability have a common origin. The probabilities that two sequences are similar through chance (independent origins) are very low. Phylogeny is inferred by measuring sequence similarity.
15	Probing for a match The ability to take a piece of known sequence and mix it with diverse pieces and then determine if any piece in the mix is an exact match is the source of the power of DNA technology. Ability to find exact complement out of billions of combinations allows one to find ‘a needle in a haystack’.
16	Human Genetic Uniqueness Though we share most sequences with all other humans, each individual can be uniquely identified genetically (with the exception of identical twins). DNA survives outside of the body and usually some long pieces can be recovered from bits of tissue a 100 years old. DNA testing has resulted in the exoneration of many individuals convicted of crimes based on techniques available before it was possible to run DNA tests (especially true in rape cases).
17	Separating DNA by size The phosphate groups in the DNA backbone have a negative charge. Gel electrophoresis separates DNA pieces by their length. Shorter lengths migrate more quickly through the ‘maze’ of gel strands. The nucleic acid molecule migrate toward the positive pole of an electrical gradient.
18	RNA, another nucleic acid RNA has the ribose sugar instead of deoxyribose. RNA has Uracil (U) in place of Thymine as a pyrimidine. The most important difference is that RNA molecules are normally single stranded rather than double stranded like DNA.
19	Types of RNA Messenger RNA carries the information necessary to build a protein. Transfer RNA is connected to amino acids and assures the order of amino acids as the message is translated. Ribosomal RNA is the major component of the ribosome, the organelle on which translation takes place.
20	Folding single strands Single-stranded RNA often has regions (6-12 bases long) in different places that would be complementary if the molecule folded back on itself. The folds create double-stranded regions and allow a greater diversity of shape in RNA (compared to DNA). RNA molecules are shorted than DNA and take on diverse shapes and configurations.
21	The Central Dogma DNA makes DNA = replication DNA makes RNA = transcription RNA makes protein = translation DNA stores information and allows it to be transmitted. Proteins perform function.
22	Proteins As with DNA, proteins are made up as a sequence of subunits. The order of the amino acids determines the properties of the protein. Though the first molecules sequenced were proteins, today it is much easier to sequence nucleic acids. The amino acid sequence can be determined from the DNA.
23	Amino acids All amino acids have a central carbon that is attached to: A hydrogen An amino group –NH₂ A carboxyl acid group –COOH A ‘side chain’ of which there are 20 different types.
24	Protein Function The 3D shape of the protein is what enables the protein to perform specialized functions. The side chains of amino acids have diversity in polarity, charge and elemental composition. That diversity is what creates the possibility of fine adjustments to shape.
25	Problem If there are 20 possible amino acids per position, what is the minimum length of a polypeptide (# of units) that would have over 1 million possible different sequences?
26	Vocabulary ‘Backbone’ Base pairing Combinations Complementary Consecutive Directional Electrophoresis Genetic uniqueness Position Primary structure Probability Sequence