Methods

Theoretical Notes

 Experimental Design

Data Analysis

Primer Design

 Endogenous Control Primer Sequences:

Gene

Forward Primer Sequence
Length (bases)

Tm (degC)

Reverse Primer Sequence

Length (bases)

Tm (degC)
Expected Size from cDNA (bp) Expected Size from Genomic DNA (bp)
GAPDH TTGCCATCAATGACCCCTTCA

21

58.4
CGCCCCACTTGATTTTGGA

19

56.7

173

392
b-actin CGTCTTCCCCTCCATCG

17

54.8
CTCGTTAATGTCACGCAC

18

51.7

94

-
b2M CCTGAATTGCTATGTGTCTGGG

22

56.9
TGATGCTGCTTACATGTCTCGA

22

57.7

-

-
18s rRNA GTAACCCGTTGAACCCCATT

20

56.4
CCATCCAATCGGTAGTAGCG

20

55.8

-

-
c-myc TCAAGAGGTGCCACGTCTCC

20

60.1
TCTTGGCAGCAGGATAGTCCTT

22

59.5

-

-

 

 

Methods

Theoretical Notes

 Experimental Design

Data Analysis

Primer Design

 RRC Core Genomics Facility
University of Illinois at Chicago
2003